Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250518

Morpholino Name: tnik MO2
Synonyms: XTNIK-MO1
Target mRNA: tnik

Morpholino Type: uncategorized morpholino
Sequence: 5' GGGAGTCGCTCGCCATGTTTCCTTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' AAAGGAAACATGGCGAGCGACTCCC 3' ||||||||||||||||||||||||| 3' TTTCCTTTGTACCGCTCGCTGAGGG 5' 5' AAAGGAAACATGGCGAGCGACTCCC 3' ||||||||||||||||||||||||| 3' TTTCCTTTGTACCGCTCGCTGAGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:92456666..92456690 25/25 Antisense target tnik.S
chr5L:107962370..107962394 25/25 Antisense off-target LOC108717011 [provisional:tnik]
chr5L:81153672..81153696 22/25 unknown
tropicalis 10.0 Chr5:111489811..111489835 25/25 Antisense target tnik
Publications
First: Traf2- and Nck-interacting kinase is essential for canonical Wnt signaling in Xenopus axis formation., J Biol Chem 2010  
Most recent: Agonistic and antagonistic roles for TNIK and MINK in non-canonical and canonical Wnt signalling., PLoS One 2012                  
View All Papers