Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250519

Morpholino Name: tp53 MO1
Synonyms: Tp53 MO, p53, p53 MO
mRNA Target: tp53

Morpholino Type: uncategorized morpholino
Sequence:
5' CCATGCCGGTCTCAGAGGAAGGTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GAACCTTCTTCTGAGACCGGCATGG 3' |||||||| |||||||||||||||| 3' CTTGGAAGGAGACTCTGGCCGTACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold104034:171..195 25/25 unknown
Scaffold357580:474..498 25/25 unknown
Scaffold105138:20228..20252 21/25 unknown
tropicalis 7.1 scaffold_297:48952..48976 24/25 Antisense target tp53
Publications
First: Links between tumor suppressors: p53 is required for TGF-beta gene responses by cooperating with Smads., Cell 2003    
Most recent: Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders., Nature 2018  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556