Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250520

Morpholino Name: tp53 MO2
Synonyms: xp53-MO
mRNA Target: tp53

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCGGTCTCAGAGGAAGGTTCCATT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' CATGGAACCTTCTTCTGAGACCGGC 3' ||||||||||| |||||||||||| 3' TTACCTTGGAAGGAGACTCTGGCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold104034:175..199 25/25 unknown
Scaffold357580:470..494 25/25 unknown
Scaffold105138:20232..20256 23/25 unknown
tropicalis 7.1 scaffold_297:48956..48980 23/25 Antisense target tp53
scaffold_1:55135078..55135102 21/25 unknown
scaffold_66:157528..157552 21/25 unknown
Publications
First: Interplay between the tumor suppressor p53 and TGF beta signaling shapes embryonic body axes in Xenopus., Development 2003    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556