Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250521

Morpholino Name: tp53 MO3
Synonyms: Xtp53MO
mRNA Target: tp53

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCGGTCTCAGAAGAAGGTCCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CATGGAACCTTCTTCTGAGACCGGC 3' ||||| ||||||||||||||||||| 3' GTACCCTGGAAGAAGACTCTGGCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold104034:175..199 22/25 unknown
Scaffold357580:470..494 22/25 unknown
tropicalis 7.1 scaffold_297:48956..48980 24/25 Antisense target tp53
Publications
First: Loss of Xenopus tropicalis EMSY causes impairment of gastrulation and upregulation of p53., N Biotechnol 2011                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556