Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250522

Morpholino Name: tp53bp1 MO1
Synonyms: 53bp1, TGas057k10, Xt53bp1
mRNA Target: tp53bp1

Morpholino Type:
Sequence:
5' AGCTGATTCTTTGAAGGGTCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 22/24
genomic

MO
5' GATGGACCCTTCAAAGAATCAGCT 3' |||||||||||||||||||||||| 3' CTACCTGGGAAGTTTCTTAGTCGA 5' 5' GATGGACCCTTCAAGGAATCCGCT 3' |||||||||||||| ||||| ||| 3' CTACCTGGGAAGTTTCTTAGTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold106789:2206806-2206829 22/24 Antisense target tp53bp1.S
Scaffold133669:2283716-2283739 21/24 Sense off-target Xelaev16009812m
Scaffold9266:5999501-5999524 21/24 Antisense off-target Xelaev16078769m
Scaffold229342:278083-278106 20/24 unknown
Scaffold44494:5470583-5470606 20/24 unknown
tropicalis 7.1 scaffold_3:23347257-23347280 24/24 Antisense target tp53bp1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556