Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250535

Morpholino Name: trhd MO1
Synonyms: TH MO, TH-MO
Target mRNA: trhd

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGTATTCCCACCATTTCTGCTAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25 25/25
genomic

MO
5' TCCAGCAGAAATGGTGGGAATACTT 3' | |||||||||||||||||||||| 3' GGATCGTCTTTACCACCCTTATGAA 5' 5' CCCAGCAGAAATGGTGGGAATACTT 3' || |||||||||||||||||||||| 3' GGATCGTCTTTACCACCCTTATGAA 5' 5' CCTAGCAGAAATGGTGGGAATACTT 3' ||||||||||||||||||||||||| 3' GGATCGTCTTTACCACCCTTATGAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:75434641..75434665 25/25 Antisense target trhd.S
chr9_10L:83151592..83151616 24/25 Antisense target trhd.L
chr9_10L:83151592..83151616 24/25 Antisense off-target Xelaev18045008m
chr8S:66030007..66030031 21/25 Sense off-target xpnpep2.S
chr2L:105674599..105674623 21/25 unknown
tropicalis 10.0 Chr9:47913968..47913992 23/25 Antisense target trhd
Publications
First: Tumorhead, a Xenopus gene product that inhibits neural differentiation through regulation of proliferation., Development 2001                  
Most recent: Tumorhead distribution to cytoplasmic membrane of neural plate cells is positively regulated by Xenopus p21-activated kinase 1 (X-PAK1)., Dev Biol 2007                
View All Papers