Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250548

Morpholino Name: trpv4 MO1
Synonyms: TRPV4
mRNA Target: trpv4

Morpholino Type: uncategorized morpholino
Sequence:
5' ATCTGCCATATTTTACACCTGGTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' GTACCAGGTGTAAAATATGGCGGAT 3' ||||||||||||||||||||| ||| 3' CATGGTCCACATTTTATACCGTCTA 5' 5' GTACCAGGTGTAAAATATGGCAGAT 3' ||||||||||||||||||||||||| 3' CATGGTCCACATTTTATACCGTCTA 5' 5' GTACCAGGTGTAAAATATGGCGGAT 3' ||||||||||||||||||||| ||| 3' CATGGTCCACATTTTATACCGTCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:146327385..146327409 25/25 Antisense target trpv4.L
chr1S:120382022..120382046 24/25 Antisense target trpv4.S
chr2S:96378741..96378765 21/25 Sense off-target herc2.S
chr6L:139720958..139720982 21/25 Antisense off-target trpv4l.2.L
chr6S:70233243..70233267 22/25 unknown
chr1L:78899501..78899525 21/25 unknown
chr9_10L:30685514..30685538 21/25 unknown
tropicalis 10.0 Chr1:147244927..147244951 24/25 Antisense target trpv4
Chr6:138106694..138106718 24/25 Antisense off-target Xetrov107045377m.g
Chr6:138106694..138106718 24/25 Antisense off-target trpv4l.4
Chr6:138062167..138062191 23/25 Antisense off-target Xetrov107045377m.g
Chr6:138062167..138062191 23/25 Antisense off-target trpv4l.3
Chr6:137941601..137941625 21/25 Antisense off-target Xetrov107045364m.g
Chr7:110584910..110584934 21/25 Antisense off-target chuk
Chr1:108527668..108527692 21/25 unknown
Chr1:74222665..74222689 21/25 unknown
Chr7:58661656..58661680 21/25 unknown
Publications
First: Mechanosensitive TRPC1 channels promote calpain proteolysis of talin to regulate spinal axon outgrowth., J Neurosci 2013  
Most recent:
View All Papers