Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250549

Morpholino Name: tsc22d1 MO1
Synonyms: TSC-22-MO, XTSC-22-MO
mRNA Target: tsc22d1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGCTGACAGACCCCAAGATCCATAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CTATGGATCTTGGGGTCTGCCAGCT 3' ||||||||||||||||||| ||||| 3' GATACCTAGAACCCCAGACAGTCGA 5' 5' CTATGGATCTTGGGGTCTGTCAGCT 3' ||||||||||||||||||||||||| 3' GATACCTAGAACCCCAGACAGTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:134116084..134116108 25/25 Antisense target tsc22d1.L
chr2S:116075925..116075949 25/25 Antisense off-target LOC108709791 [provisional:tsc22d1]
tropicalis 10.0 Chr2:133635836..133635860 24/25 Antisense target tsc22d1
Chr3:6657278..6657302 21/25 Antisense off-target nup205
Chr6:37281546..37281570 21/25 unknown
Publications
First: Role of TSC-22 during early embryogenesis in Xenopus laevis., Dev Growth Differ 2004                  
Most recent: TSC-box is essential for the nuclear localization and antiproliferative effect of XTSC-22., Dev Growth Differ 2007  
View All Papers