Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250549

Morpholino Name: tsc22d1 MO1
Synonyms: TSC-22-MO, XTSC-22-MO
mRNA Target: tsc22d1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGCTGACAGACCCCAAGATCCATAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTATGGATCTTGGGGTCTGTCAGCT 3' ||||||||||||||||||||||||| 3' GATACCTAGAACCCCAGACAGTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14978:6464952..6464976 25/25 Antisense target tsc22d1.L
Scaffold8129:3629146..3629170 25/25 Antisense off-target Xelaev16074598m
tropicalis 7.1 scaffold_2:75243659..75243683 24/25 unknown
scaffold_3:1957273..1957297 21/25 Antisense off-target nup205
scaffold_6:108321710..108321734 21/25 unknown
Publications
First: Role of TSC-22 during early embryogenesis in Xenopus laevis., Dev Growth Differ 2004                  
Most recent: TSC-box is essential for the nuclear localization and antiproliferative effect of XTSC-22., Dev Growth Differ 2007  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556