Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250550

Morpholino Name: tshz1 MO1
Synonyms: XTsh1 MO, XTsh1-MO
mRNA Target: tshz1

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCTTCCGCAGGGCTTCTCCACTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGAGTGGAGAAGCCCTGCGGAAGCC 3' ||||||||||||||||||||||||| 3' CCTCACCTCTTCGGGACGCCTTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold210343:3606358..3606382 25/25 Antisense target tshz1.L
Scaffold5925:13864809..13864833 21/25 Sense off-target Xelaev16065005m
tropicalis 7.1 scaffold_6:50250474..50250498 24/25 unknown
Publications
First: Xenopus Teashirt1 regulates posterior identity in brain and cranial neural crest., Dev Biol 2006                                
Most recent: A hindbrain-repressive Wnt3a/Meis3/Tsh1 circuit promotes neuronal differentiation and coordinates tissue maturation., Development 2012                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556