Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250551

Morpholino Name: tsku MO1
Synonyms: X-TSK, X-TSK, X-TSK morpholino
mRNA Target: tsku

Morpholino Type: uncategorized morpholino
Sequence:
5' CCAAGAAGAAAGAGCCATTGTTAGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TCTAACAATGGCTCTTTCTTCTTGG 3' ||||||||||||||||||||||||| 3' AGATTGTTACCGAGAAAGAAGAACC 5' 5' TCTAACAATGGCTCTTTCTTCTTGG 3' ||||||||||||||||||||||||| 3' AGATTGTTACCGAGAAAGAAGAACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:180228109..180228133 25/25 Antisense target tsku.L
chr2S:154292206..154292230 25/25 Antisense target tsku.S
chr9_10L:15884406..15884430 22/25 Sense off-target LOC108700933 [provisional:cdh26]
chr5L:140309340..140309364 22/25 unknown
Scaffold34:2086366..2086390 21/25 unknown
chr3L:71982197..71982221 21/25 unknown
chr4S:59613537..59613561 21/25 unknown
tropicalis 10.0 Chr3:20807193..20807217 21/25 unknown
Publications
First: Tsukushi functions as an organizer inducer by inhibition of BMP activity in cooperation with chordin., Dev Cell 2004          
Most recent: Tsukushi modulates Xnr2, FGF and BMP signaling: regulation of Xenopus germ layer formation., PLoS One 2007                      
View All Papers