Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250552

Morpholino Name: tspan1 MO1
Synonyms: TMO1
mRNA Target: tspan1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATTGTTCTGGCTGAAAGTTCCCTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2S:124138772..124138796 21/25 Antisense off-target LOC108709870 [provisional:agap2]
chr2L:83148132..83148156 21/25 unknown
chr3L:122655765..122655789 21/25 unknown
tropicalis 10.0 Chr5:92282561..92282585 21/25 Sense off-target rims1
Publications
First: Xenopus Tetraspanin-1 regulates gastrulation movements and neural differentiation in the early Xenopus embryo., Differentiation 2007            
Most recent:
View All Papers