Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250553

Morpholino Name: tspan1 MO2
Synonyms: TMO2
mRNA Target: tspan1

Morpholino Type: uncategorized morpholino
Sequence:
5' TGATAAACGAGAAACACCCCATTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genomic

MO
5' ACAATGGGGTGCTTCACATTTATCA 3' ||||||||||| ||| | ||||||| 3' TGTTACCCCACAAAGAGCAAATAGT 5' 5' ACAATGGGGTGTTTCTCGTTTATCA 3' ||||||||||||||||||||||||| 3' TGTTACCCCACAAAGAGCAAATAGT 5' 5' ACAATGGGGTGTTTCACATTTATCA 3' ||||||||||||||| | ||||||| 3' TGTTACCCCACAAAGAGCAAATAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:82678229..82678253 25/25 Antisense target tspan1.L
chr4S:66766688..66766712 23/25 Antisense target tspan1.S
tropicalis 10.0 Chr4:92920626..92920650 22/25 Antisense target tspan1
Publications
First: Xenopus Tetraspanin-1 regulates gastrulation movements and neural differentiation in the early Xenopus embryo., Differentiation 2007            
Most recent:
View All Papers