Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250554

Morpholino Name: tspan8 MO1
Synonyms: tm4sf3 utr
mRNA Target: tspan8

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGTGGGAAACGAAGAGCTTCTTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' TCAAGAAGCTCTTCAGTTCTCACAT 3' |||||||||||||| ||| ||||| 3' AGTTCTTCGAGAAGCAAAGGGTGTA 5' 5' TCAAGAAGCTCTTCGTTTCCCACAT 3' ||||||||||||||||||||||||| 3' AGTTCTTCGAGAAGCAAAGGGTGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:51980269..51980293 25/25 Antisense target tspan8.L
tropicalis 10.0 Chr3:59648355..59648379 22/25 Antisense target tspan8
Publications
First: The tetraspanin Tm4sf3 is localized to the ventral pancreas and regulates fusion of the dorsal and ventral pancreatic buds., Development 2009                    
Most recent:
View All Papers