Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250555

Morpholino Name: tspan8 MO2
Synonyms: tm4sf3 start
mRNA Target: tspan8

Morpholino Type: uncategorized morpholino
Sequence:
5' CACTTGCTAACCCCAGCCATTTTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CCAAAATGGCCGGGGTTAGCAAGTG 3' |||||||||| |||||||||||||| 3' GGTTTTACCGACCCCAATCGTTCAC 5' 5' CCAAAATGGCTGGGGTTAGCAAGTG 3' ||||||||||||||||||||||||| 3' GGTTTTACCGACCCCAATCGTTCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:51980236..51980260 25/25 Antisense target tspan8.L
chr7L:123011708..123011732 21/25 Sense off-target LOC108696895 [provisional:zbed6]
chr3S:86513623..86513647 24/25 unknown
chr6S:70551711..70551735 21/25 unknown
tropicalis 10.0 Chr3:59648322..59648346 24/25 Antisense target tspan8
Publications
First: The tetraspanin Tm4sf3 is localized to the ventral pancreas and regulates fusion of the dorsal and ventral pancreatic buds., Development 2009                    
Most recent:
View All Papers