Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250556

Morpholino Name: ttc25 MO1
Synonyms: TTC25 MO, TTC25 morpholino
mRNA Target: odad4

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCGAGAGTTGGCGTTACCTTGAAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:828198..828222 25/25 Antisense off-target ttc25.L
Scaffold75:88360..88384 21/25 unknown
Publications
First: Identification of novel ciliogenesis factors using a new in vivo model for mucociliary epithelial development., Dev Biol 2007                                            
Most recent: RFX2 is broadly required for ciliogenesis during vertebrate development., Dev Biol 2012                                                            
View All Papers