Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250557

Morpholino Name: twist1 MO1
Synonyms: twist1 MO
Target mRNA: twist1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGACTCTTCCTGCATCATTTTCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 24/24 24/24
genomic

MO
5' GAGAAAATGATGCAGGAAGAGTCC 3' |||||||||||||||||||||||| 3' CTCTTTTACTACGTCCTTCTCAGG 5' 5' GAGAAAATGATGCAGGAAGAGTCC 3' |||||||||||||||||||||||| 3' CTCTTTTACTACGTCCTTCTCAGG 5' 5' GAGAAAATGATGCAGGAAGAGTCC 3' |||||||||||||||||||||||| 3' CTCTTTTACTACGTCCTTCTCAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:37002342..37002365 24/24 Antisense target twist1.L
chr6S:30545284..30545307 24/24 Antisense target twist1.S
chr2S:52602242..52602265 20/24 Antisense off-target LOC108708909 [provisional:pik3c2b]
chr3S:83207066..83207089 20/24 Sense off-target slc16a7.S
chr4S:87269098..87269121 20/24 Sense off-target gucy2c.S
chr9_10S:10822059..10822082 20/24 Sense off-target tshz2.S
chr9_10S:76381811..76381834 20/24 Antisense off-target fscn1.S
chr3S:105546200..105546223 21/24 unknown
chr2S:56152242..56152265 20/24 unknown
chr2S:82588103..82588126 20/24 unknown
chr4S:98333430..98333453 20/24 unknown
chr2S:20332847..20332870 20/24 unknown
tropicalis 10.0 Chr6:38450825..38450848 24/24 Antisense target twist1
Chr1:135501663..135501686 20/24 Sense off-target aopep
Chr10:32067589..32067612 20/24 Sense off-target sdk2
Chr2:112557662..112557685 20/24 Sense off-target rev1
Chr4:16420462..16420485 20/24 Antisense off-target ppfibp2
Chr4:37037325..37037348 20/24 Sense off-target tesmin
Chr5:102630715..102630738 21/24 unknown
Chr1:47554258..47554281 20/24 unknown
Chr8:90099297..90099320 20/24 unknown
Publications
First: Unexpected functional redundancy between Twist and Slug (Snail2) and their feedback regulation of NF-kappaB via Nodal and Cerberus., Dev Biol 2009      
Most recent: Snail2 controls mesodermal BMP/Wnt induction of neural crest., Development 2011                    
View All Papers