Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250558

Morpholino Name: twist1 MO2
Synonyms: twist, twist1
Target mRNA: twist1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGACTCTTCCTGCATCATTTTCTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GGAGAAAATGATGCAGGAAGAGTCC 3' ||||||||||||||||||||||||| 3' CCTCTTTTACTACGTCCTTCTCAGG 5' 5' GGAGAAAATGATGCAGGAAGAGTCC 3' ||||||||||||||||||||||||| 3' CCTCTTTTACTACGTCCTTCTCAGG 5' 5' GGAGAAAATGATGCAGGAAGAGTCC 3' ||||||||||||||||||||||||| 3' CCTCTTTTACTACGTCCTTCTCAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:37002341..37002365 25/25 Antisense target twist1.L
chr6S:30545284..30545308 25/25 Antisense target twist1.S
chr2S:20332847..20332871 21/25 unknown
chr3S:105546200..105546224 21/25 unknown
tropicalis 10.0 Chr6:38450825..38450849 25/25 Antisense target twist1
Chr2:112557662..112557686 21/25 Sense off-target rev1
Chr1:47554257..47554281 21/25 unknown
Chr5:102630714..102630738 21/25 unknown
Publications
First: Unexpected functional redundancy between Twist and Slug (Snail2) and their feedback regulation of NF-kappaB via Nodal and Cerberus., Dev Biol 2009      
Most recent: Snail2 controls mesodermal BMP/Wnt induction of neural crest., Development 2011                    
View All Papers