Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250559

Morpholino Name: twist1 MO3
Synonyms: XTwist
Target mRNA: twist1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGACTCTTCCTGCATCATTTTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 24/24 24/24
genomic

MO
5' AGAAAATGATGCAGGAAGAGTCCA 3' |||||||||||||||||||||||| 3' TCTTTTACTACGTCCTTCTCAGGT 5' 5' AGAAAATGATGCAGGAAGAGTCCA 3' |||||||||||||||||||||||| 3' TCTTTTACTACGTCCTTCTCAGGT 5' 5' AGAAAATGATGCAGGAAGAGTCCA 3' |||||||||||||||||||||||| 3' TCTTTTACTACGTCCTTCTCAGGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:37002343..37002366 24/24 Antisense target twist1.L
chr6S:30545283..30545306 24/24 Antisense target twist1.S
chr9_10S:10822058..10822081 21/24 Sense off-target tshz2.S
chr2S:52602243..52602266 20/24 Antisense off-target LOC108708909 [provisional:pik3c2b]
chr3S:83207065..83207088 20/24 Sense off-target slc16a7.S
chr3S:105546199..105546222 22/24 unknown
chr2S:20332846..20332869 20/24 unknown
chr2S:56152241..56152264 20/24 unknown
chr4S:79467894..79467917 20/24 unknown
chr4S:98333431..98333454 20/24 unknown
chr7S:58293694..58293717 20/24 unknown
tropicalis 10.0 Chr6:38450824..38450847 24/24 Antisense target twist1
Chr10:32067590..32067613 20/24 Sense off-target sdk2
Chr2:112557661..112557684 20/24 Sense off-target rev1
Chr4:37037324..37037347 20/24 Sense off-target tesmin
Chr6:35912582..35912605 20/24 Antisense off-target scin
Chr5:102630716..102630739 20/24 unknown
Publications
First: A Myc-Slug (Snail2)/Twist regulatory circuit directs vascular development., Development 2008                
Most recent:
View All Papers