Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250560

Morpholino Name: twsg1 MO1
Synonyms: TSG MO, TSG-MO
Target mRNA: twsg1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGGAAAGAGGGCTTCATACTTGGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' GGCCAAGTATGAAGCCCTCTCTCCT 3' |||||||||||||||||||| |||| 3' CCGGTTCATACTTCGGGAGAAAGGA 5' 5' GGCCAAGTATGAAGCCCTCTTTCCT 3' ||||||||||||||||||||||||| 3' CCGGTTCATACTTCGGGAGAAAGGA 5' 5' GGCCAAGTATGAAGCCCTCTTTCCT 3' ||||||||||||||||||||||||| 3' CCGGTTCATACTTCGGGAGAAAGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:103959699..103959723 25/25 Antisense target twsg1.L
chr6S:82735967..82735991 25/25 Antisense target twsg1.S
tropicalis 10.0 Chr6:104564639..104564663 24/25 Antisense target twsg1
Publications
First: Twisted gastrulation loss-of-function analyses support its role as a BMP inhibitor during early Xenopus embryogenesis., Development 2003                
Most recent: Crossveinless-2 Is a BMP feedback inhibitor that binds Chordin/BMP to regulate Xenopus embryonic patterning., Dev Cell 2008                              
View All Papers