Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250562

Morpholino Name: twsg1 MO3
Synonyms: tsg MO
Target mRNA: twsg1

Morpholino Type: uncategorized morpholino
Sequence: 5' TAGGAGAGAGGGCTTCATACTTGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 24/25
genomic

MO
5' GCCAAGTATGAAGCCCTCTCTCCTA 3' ||||||||||||||||||||||||| 3' CGGTTCATACTTCGGGAGAGAGGAT 5' 5' GCCAAGTATGAAGCCCTCTTTCCTT 3' ||||||||||||||||||| |||| 3' CGGTTCATACTTCGGGAGAGAGGAT 5' 5' GCCAAGTATGAAGCCCTCTTTCCTA 3' ||||||||||||||||||| ||||| 3' CGGTTCATACTTCGGGAGAGAGGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6S:82735966..82735990 24/25 Antisense target twsg1.S
chr6L:103959700..103959724 23/25 Antisense target twsg1.L
chr1S:171005539..171005563 21/25 unknown
chr5L:119697892..119697916 21/25 unknown
chr5L:130512599..130512623 21/25 unknown
tropicalis 10.0 Chr6:104564640..104564664 25/25 Antisense target twsg1
Publications
First: Twisted gastrulation is required for forebrain specification and cooperates with Chordin to inhibit BMP signaling during X. tropicalis gastrulation., Dev Biol 2006                                    
Most recent:
View All Papers