Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250563

Morpholino Name: ubp1 MO1
Synonyms: ubp1
mRNA Target: ubp1

Morpholino Type:
Sequence:
5' AAAGTAGGGAATGCACCTTAAAAAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13265:2612818-2612842 25/25 Antisense off-target Xelaev16009300m
Scaffold75417:5436540-5436564 23/25 Antisense off-target Xelaev16072025m
Scaffold18726:490269-490293 21/25 unknown
tropicalis 7.1 scaffold_1:113786846-113786870 23/25 unknown
scaffold_1:79946496-79946520 21/25 unknown
Publications
First: Specification of ion transport cells in the Xenopus larval skin. [Development 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556