Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250564

Morpholino Name: ubp1 MO2
Synonyms: ubp1
mRNA Target: ubp1

Morpholino Type:
Sequence:
5' GGTTGGCTGTGCCAAAACAACATGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold75417:5432983-5433007 25/25 unknown
Scaffold13265:2608795-2608819 22/25 Antisense off-target Xelaev16009300m
Scaffold163806:6618099-6618123 22/25 Antisense off-target tfcp2l1.S
Scaffold207208:2881181-2881205 21/25 unknown
Scaffold33269:2494621-2494645 21/25 unknown
Publications
First: Specification of ion transport cells in the Xenopus larval skin. [Development 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556