Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250565

Morpholino Name: ugdh MO1
Synonyms: xUGDH MO
mRNA Target: ugdh

Morpholino Type:
Sequence:
5' CATGGTTTATCTTGCTGAGAACAGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold106892:637218..637242 21/25 unknown
Scaffold17127:2490097..2490121 21/25 unknown
Scaffold18892:6075338..6075362 21/25 unknown
Scaffold298574:88070..88094 21/25 Antisense off-target tor2a.L
Scaffold43242:9612310..9612334 21/25 unknown
Scaffold53042:2460018..2460042 21/25 unknown
Scaffold70246:683827..683851 21/25 Sense off-target ppfibp1.S
Scaffold83106:1571833..1571857 21/25 Antisense off-target Xelaev16075419m
tropicalis 7.1 scaffold_2:59255019..59255043 21/25 unknown
scaffold_5:32911874..32911898 21/25 unknown
Publications
First: Molecular cloning and characterization of UDP-glucose dehydrogenase from the amphibian Xenopus laevis and its involvement in hyaluronan synthesis. [J Biol Chem 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556