Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250566

Morpholino Name: unc45b MO1
Synonyms: unc45b splice
mRNA Target: unc45b

Morpholino Type:
Sequence:
5' AGCACACATTATTCTTACCCAGTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTACTGGGTAAGAATAATGTGTGCT 3' ||||||||||||||||||||||||| 3' CATGACCCATTCTTATTACACACGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold243:737507-737531 21/25 Sense off-target Xelaev16032264m
Scaffold63567:2037278-2037302 21/25 unknown
Scaffold7440:884741-884765 21/25 unknown
Scaffold9266:7354681-7354705 21/25 unknown
tropicalis 7.1 scaffold_2:16768453-16768477 25/25 Antisense target unc45b
scaffold_1:67091898-67091922 21/25 Antisense off-target kiaa1324
scaffold_2:16002088-16002112 21/25 Antisense off-target bcas3
scaffold_2:35148373-35148397 21/25 unknown
Publications
First: Paralysis and delayed Z-disc formation in the Xenopus tropicalis unc45b mutant dicky ticker. [BMC Dev Biol 2010]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556