Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250567

Morpholino Name: unc45b MO2
Synonyms: unc45b ATG
mRNA Target: unc45b

Morpholino Type:
Sequence:
5' CCTTTAGCTGCACTGGGTCTTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' ATGGAAGACCCAGTGCAGCTAAAGG 3' ||||||||||||||||||||||||| 3' TACCTTCTGGGTCACGTCGATTTCC 5' 5' ATGGAAGACCCCGTGCAGCTAAAGG 3' ||||||||||| ||||||||||||| 3' TACCTTCTGGGTCACGTCGATTTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold267344:2568392-2568416 25/25 Antisense off-target Xelaev16035935m
Scaffold47398:2388185-2388209 24/25 Antisense target unc45b.S
Scaffold106892:40587-40611 21/25 unknown
tropicalis 7.1 scaffold_2:16764345-16764369 25/25 Antisense target unc45b
Publications
First: Paralysis and delayed Z-disc formation in the Xenopus tropicalis unc45b mutant dicky ticker. [BMC Dev Biol 2010]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556