Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250569

Morpholino Name: unc5b MO2
Synonyms: Unc5B-UTR MO
mRNA Target: unc5b

Morpholino Type: uncategorized morpholino
Sequence:
5' ACAATGCCAAGGTGTCCCGCAAGCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGCTTGCGGGACACCTTGGCATTGT 3' ||||||||||||||||||||||||| 3' ACGAACGCCCTGTGGAACCGTAACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold32511:1229088..1229112 25/25 Antisense target unc5b.L
Scaffold69443:4812637..4812661 24/25 Sense off-target Xelaev16068872m
Scaffold90484:515562..515586 24/25 Antisense off-target Xelaev16078198m
tropicalis 7.1 scaffold_7:44222944..44222968 24/25 unknown
Publications
First: Unc5B interacts with FLRT3 and Rnd1 to modulate cell adhesion in Xenopus embryos., PLoS One 2009                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556