Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250571

Morpholino Name: unnamed MO2
Synonyms: p75NTR morpholino, p75ntr
mRNA Target: ngfr

Morpholino Type: uncategorized morpholino
Sequence:
5' CCATGCTGATCCTAGAAAGCTGATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CATCAGCTTTATAGGATCAGCATGG 3' |||||||||| |||||||||||||| 3' GTAGTCGAAAGATCCTAGTCGTACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold75417:3386333..3386357 25/25 Antisense off-target Xelaev16071906m
Scaffold13265:531243..531267 24/25 unknown
tropicalis 7.1 scaffold_10:21972525..21972549 24/25 Antisense target unnamed
Publications
First: Pro-BDNF-induced synaptic depression and retraction at developing neuromuscular synapses., J Cell Biol 2009                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556