Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250575

Morpholino Name: vamp3 MO1
Synonyms: V3 MO, VAMP3 MO
mRNA Target: vamp3

Morpholino Type:
Sequence:
5' GGACACCGGTCCGACTTTACTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/22
genomic

MO
5' GAGTAAAGTCGGACCGGTGTCC 3' |||||||||||||||||||||| 3' CTCATTTCAGCCTGGCCACAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold87017:310148-310169 22/22 unknown
tropicalis 7.1 scaffold_7:96140897-96140918 22/22 Antisense target vamp3
Publications
First: Identification of a novel Bves function: regulation of vesicular transport. [EMBO J 2010]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556