Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250576

Morpholino Name: vangl2 MO1
Synonyms: Vangl2
mRNA Target: vangl2

Morpholino Type:
Sequence:
5' ACTGGGAATCGTTGTCCATGTTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24 23/24 22/24
genomic

MO
5' AAAACATGGACAACGACTCCCAGT 3' ||||||||||||||| ||||||| 3' CTTTGTACCTGTTGCTAAGGGTCA 5' 5' AAAACATGGACAACGATTCCCAGT 3' ||||||||||||||||||||||| 3' CTTTGTACCTGTTGCTAAGGGTCA 5' 5' AAAACATGGACAATGATTCCCAGT 3' |||||||||||| |||||||||| 3' CTTTGTACCTGTTGCTAAGGGTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold226:554557-554580 23/24 Antisense target vangl2.L
Scaffold120240:1592094-1592117 22/24 unknown
Scaffold41091:2015296-2015319 22/24 Antisense target vangl2.S
Scaffold102974:11840836-11840859 20/24 Sense off-target Xelaev16000793m
tropicalis 7.1 scaffold_8c:2756809-2756832 22/24 Antisense target vangl2
scaffold_2:125139345-125139368 20/24 unknown
scaffold_4:18117507-18117530 20/24 unknown
scaffold_4:18655483-18655506 20/24 unknown
scaffold_4:18697050-18697073 20/24 unknown
scaffold_4:18711387-18711410 20/24 unknown
scaffold_4:18730932-18730955 20/24 unknown
scaffold_4:18748768-18748791 20/24 unknown
scaffold_4:18768799-18768822 20/24 unknown
scaffold_4:7450967-7450990 20/24 unknown
Publications
First: Beta-catenin signaling activity dissected in the early Xenopus embryo: a novel antisense approach. [Dev Biol 2000]
Most recent: The human PDZome: a gateway to PSD95-Disc large-zonula occludens (PDZ)-mediated functions. [Mol Cell Proteomics 2013]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556