Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250576

Morpholino Name: vangl2 MO1
Synonyms: Vangl2
Target mRNA: vangl2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTGGGAATCGTTGTCCATGTTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24 23/24 22/24
genomic

MO
5' AAAACATGGACAACGACTCCCAGT 3' ||||||||||||||| ||||||| 3' CTTTGTACCTGTTGCTAAGGGTCA 5' 5' AAAACATGGACAACGATTCCCAGT 3' ||||||||||||||||||||||| 3' CTTTGTACCTGTTGCTAAGGGTCA 5' 5' AAAACATGGACAATGATTCCCAGT 3' |||||||||||| |||||||||| 3' CTTTGTACCTGTTGCTAAGGGTCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:112211820..112211843 23/24 Antisense target vangl2.L
chr8S:94049592..94049615 22/24 Antisense target vangl2.S
chr5L:10416860..10416883 20/24 Sense off-target ubr2.L
chr9_10L:86201882..86201905 22/24 unknown
tropicalis 10.0 Chr8:137136566..137136589 22/24 Antisense target vangl2
Chr4:20023460..20023483 20/24 Sense off-target kcna4
Chr4:20064492..20064515 20/24 Sense off-target LOC116410304
Chr4:20080401..20080424 20/24 Sense off-target LOC116410304
Chr4:20099935..20099958 20/24 Sense off-target LOC116410304
Chr4:20117660..20117683 20/24 Sense off-target LOC116410304
Chr4:20157370..20157393 20/24 Sense off-target LOC101732864
Chr4:20176467..20176490 20/24 Sense off-target LOC101732864
Chr4:20176467..20176490 20/24 Antisense off-target Xetrov107028635m.g
Chr8:17057247..17057270 20/24 Sense off-target LOC108648827
Chr2:19803955..19803978 20/24 unknown
Chr4:19547638..19547661 20/24 unknown
Chr4:20144477..20144500 20/24 unknown
Chr8:17421933..17421956 20/24 unknown
Publications
First: Beta-catenin signaling activity dissected in the early Xenopus embryo: a novel antisense approach., Dev Biol 2000          
Most recent: The human PDZome: a gateway to PSD95-Disc large-zonula occludens (PDZ)-mediated functions., Mol Cell Proteomics 2013                    
View All Papers