Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250578

Morpholino Name: vangl2 MO3
Synonyms: Vangl2
mRNA Target: vangl2

Morpholino Type:
Sequence:
5' AGTACCGGCTTTTGTGGCGATCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/24 24/24 24/24
genomic

MO
5' TGGAACGGCACAAAAGCCGCTACT 3' |||| || ||||||||||| |||| 3' ACCTAGCGGTGTTTTCGGCCATGA 5' 5' TGGATCGCCACAAAAGCCGGTACT 3' |||||||||||||||||||||||| 3' ACCTAGCGGTGTTTTCGGCCATGA 5' 5' TGGATCGCCACAAAAGCCGGTACT 3' |||||||||||||||||||||||| 3' ACCTAGCGGTGTTTTCGGCCATGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold226:554584-554607 24/24 Antisense target vangl2.L
Scaffold41091:2015269-2015292 24/24 Antisense target vangl2.S
tropicalis 7.1 scaffold_8c:2756782-2756805 21/24 Antisense target vangl2
Publications
First: Syndecan 4 interacts genetically with Vangl2 to regulate neural tube closure and planar cell polarity. [Development 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556