Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250579

Morpholino Name: vav2 MO1
Synonyms: xVav2 MO
mRNA Target: vav2

Morpholino Type:
Sequence:
5' CTGCCGCCAGCCCTCAGTCATGTTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold251007:255419-255443 25/25 Antisense off-target Xelaev16033368m
Scaffold255149:363093-363117 23/25 Antisense off-target Xelaev16034432m
Publications
First: Balanced Vav2 GEF activity regulates neurite outgrowth and branching in vitro and in vivo. [Mol Cell Neurosci 2010]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556