Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250580

Morpholino Name: vcl MO1
Synonyms: Vinculin-MO
mRNA Target: vcl

Morpholino Type: uncategorized morpholino
Sequence:
5' TATGGAAGACCGGCATCTTGGCAAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ACTGCCAAGATGCCGGTCTTCCACA 3' | ||||||||||||||||||||| | 3' TAACGGTTCTACGGCCAGAAGGTAT 5' 5' ATTGCCAAGATGCCGGTCTTCCATA 3' ||||||||||||||||||||||||| 3' TAACGGTTCTACGGCCAGAAGGTAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold139078:1361681..1361705 25/25 Antisense target vcl.S
tropicalis 7.1 scaffold_4:11235771..11235795 23/25 Antisense target vcl
Publications
First: A dominant-negative provides new insights into FAK regulation and function in early embryonic morphogenesis., Development 2013  
Most recent: Decoupling the Roles of Cell Shape and Mechanical Stress in Orienting and Cueing Epithelial Mitosis., Cell Rep 2019                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556