Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250581

Morpholino Name: vegfa MO1
Synonyms: X.tropicalis VEGFA, gi:77626411
mRNA Target: vegfa

Morpholino Type: uncategorized morpholino
Sequence:
5' CGGTGAGGCTACAGTGTAACAGTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACACTGTTACACTGTAGCCTCACCG 3' ||||||||||||||||||||||||| 3' TGTGACAATGTGACATCGGAGTGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold141798:81489..81513 21/25 Sense off-target mkrn2.L
tropicalis 7.1 scaffold_5:122452078..122452102 25/25 Antisense target vegfa
scaffold_9:4665850..4665874 22/25 unknown
scaffold_10:21760798..21760822 21/25 unknown
scaffold_4:82753872..82753896 21/25 unknown
Publications
First: The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development., Development 2008                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556