Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250582

Morpholino Name: vegfa MO2
Synonyms: VEGF-MO, VEGFA-MO
mRNA Target: vegfa

Morpholino Type:
Sequence:
5' GATCCAGCTCGGCAGAAAGTTCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CATGAACTTTCTGCCGAGCTGGATC 3' ||||||||||||||||||||||||| 3' GTACTTGAAAGACGGCTCGACCTAG 5' 5' CATGAACTTTCTGCCGAGCTGGATC 3' ||||||||||||||||||||||||| 3' GTACTTGAAAGACGGCTCGACCTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold111824:6517992-6518016 25/25 unknown
Scaffold12020:13705153-13705177 25/25 Antisense target vegfa.L
Scaffold194193:94-118 21/25 unknown
Scaffold37227:1288886-1288910 21/25 Sense off-target Xelaev16048387m
tropicalis 7.1 scaffold_5:122452245-122452269 25/25 Antisense target vegfa
Publications
First: Paracrine and autocrine mechanisms of apelin signaling govern embryonic and tumor angiogenesis. [Dev Biol 2007]
Most recent: VEGFA-dependent and -independent pathways synergise to drive Scl expression and initiate programming of the blood stem cell lineage in Xenopus. [Development 2013]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556