Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250582

Morpholino Name: vegfa MO2
Synonyms: VEGF-MO, VEGFA-MO
mRNA Target: vegfa

Morpholino Type: uncategorized morpholino
Sequence:
5' GATCCAGCTCGGCAGAAAGTTCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CATGAACTTTCTGCCGAGCTGGATC 3' ||||||||||||||||||||||||| 3' GTACTTGAAAGACGGCTCGACCTAG 5' 5' CATGAACTTTCTGCCGAGCTGGATC 3' ||||||||||||||||||||||||| 3' GTACTTGAAAGACGGCTCGACCTAG 5' 5' CATGAACTTTCTGCCGAGCTGGATC 3' ||||||||||||||||||||||||| 3' GTACTTGAAAGACGGCTCGACCTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:23638554..23638578 25/25 Antisense target vegfa.L
chr5S:6529012..6529036 25/25 Antisense target vegfa.S
chr5L:90655676..90655700 21/25 Sense off-target LOC108716910 [provisional:eloa]
tropicalis 10.0 Chr5:1641716..1641740 25/25 Antisense target vegfa
Publications
First: Paracrine and autocrine mechanisms of apelin signaling govern embryonic and tumor angiogenesis., Dev Biol 2007                            
Most recent: VEGFA-dependent and -independent pathways synergise to drive Scl expression and initiate programming of the blood stem cell lineage in Xenopus., Development 2013                                                                                                                              
View All Papers