Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250583

Morpholino Name: vegfc MO1
Synonyms: xVEGF-C
mRNA Target: vegfc

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTCCCTCCAGCAAGTACATTTTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GGAAAATGCACTTGCTGGAGGGAGC 3' |||||||| |||||||||||||||| 3' CCTTTTACATGAACGACCTCCCTCG 5' 5' GGAAAATGTACTTGCTGGAGGGAGC 3' ||||||||||||||||||||||||| 3' CCTTTTACATGAACGACCTCCCTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:36380681..36380705 25/25 Antisense target vegfc.S
chr1L:40931713..40931737 24/25 Antisense target vegfc.L
Scaffold28:2800545..2800569 21/25 Sense off-target lca5.L
chr9_10L:97929086..97929110 21/25 unknown
Publications
First: A genetic Xenopus laevis tadpole model to study lymphangiogenesis., Nat Med 2005  
Most recent: A transgenic Xenopus laevis reporter model to study lymphangiogenesis., Biol Open 2013              
View All Papers