Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250583

Morpholino Name: vegfc MO1
Synonyms: xVEGF-C
mRNA Target: vegfc

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTCCCTCCAGCAAGTACATTTTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold41523:2500028..2500052 25/25 Antisense off-target Xelaev16052248m
Scaffold14692:6482581..6482605 24/25 Antisense off-target Xelaev16013902m
Scaffold80885:1761274..1761298 21/25 Sense off-target Xelaev16074395m
Scaffold9994:10137164..10137188 21/25 unknown
Publications
First: A genetic Xenopus laevis tadpole model to study lymphangiogenesis., Nat Med 2005  
Most recent: A transgenic Xenopus laevis reporter model to study lymphangiogenesis., Biol Open 2013              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556