Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250584

Morpholino Name: vegfc MO2
Synonyms: VEGFC morpholino
mRNA Target: vegfc

Morpholino Type: uncategorized morpholino
Sequence:
5' GTAACGCTCCCTCCAGCAAGTACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold41523:2500023..2500047 25/25 Antisense off-target Xelaev16052248m
Scaffold14692:6482586..6482610 22/25 Antisense off-target Xelaev16013902m
Scaffold230826:4854972..4854996 22/25 unknown
Publications
First: miR-31 functions as a negative regulator of lymphatic vascular lineage-specific differentiation in vitro and vascular development in vivo., Mol Cell Biol 2010  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556