Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250585

Morpholino Name: vegt MO1
Synonyms: anit MO, antipodean/vegT
mRNA Target: vegt

Morpholino Type: uncategorized morpholino
Sequence:
5' ACTTTACATCCGGCAGAGAATGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:79546888..79546912 21/25 unknown
Publications
First: Snail2 controls mesodermal BMP/Wnt induction of neural crest., Development 2011                    
Most recent:
View All Papers