Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250587

Morpholino Name: vegt MO3
Synonyms: zVegT MO
mRNA Target: vegt

Morpholino Type: uncategorized morpholino
Sequence:
5' CATCCGGCAGAGAGTGCATGTTCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 22/25
genomic

MO
5' AGGAACATGCACTCTCTGCCGGGTA 3' |||||||||||||||||||||| | 3' TCCTTGTACGTGAGAGACGGCCTAC 5' 5' AGGAACATGCATTCTCTGCCGGGTA 3' ||||||||||| |||||||||| | 3' TCCTTGTACGTGAGAGACGGCCTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold162663:575326..575350 22/25 Antisense target vegt.L
Scaffold90041:2225669..2225693 21/25 Sense off-target Xelaev16077990m
tropicalis 7.1 scaffold_1:55053515..55053539 23/25 Antisense target vegt
scaffold_1:20163537..20163561 21/25 Sense off-target slc45a2
scaffold_8:92702386..92702410 21/25 unknown
Publications
First: Zygotic VegT is required for Xenopus paraxial mesoderm formation and is regulated by Nodal signaling and Eomesodermin., Int J Dev Biol 2010                
Most recent: High-resolution analysis of gene activity during the Xenopus mid-blastula transition., Development 2014                    
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556