Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250588

Morpholino Name: vegt MO4
Synonyms: VegT-MO, vegt, vegt MO
mRNA Target: vegt

Morpholino Type: uncategorized morpholino
Sequence:
5' CCCGACAGCAGTTTCTCATTCCAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' GCTGCAATGAGAAACTGCTGTCAGG 3' |||| ||||||||||||||||| || 3' CGACCTTACTCTTTGACGACAGCCC 5' 5' GCTGGAATGAGAAACTGCTGTCGGG 3' ||||||||||||||||||||||||| 3' CGACCTTACTCTTTGACGACAGCCC 5' 5' GCTGGAATGAGAAACTGCTGTCGGG 3' ||||||||||||||||||||||||| 3' CGACCTTACTCTTTGACGACAGCCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:152598799..152598823 25/25 Antisense target vegt.L
chr1S:126245226..126245250 25/25 Antisense target vegt.S
chr4S:49200716..49200740 21/25 Antisense off-target LOC108715458 [provisional:cngb1]
chr5L:28838376..28838400 21/25 unknown
tropicalis 10.0 Chr1:152863076..152863100 23/25 Antisense target vegt
Chr5:30906646..30906670 21/25 unknown
Publications
First: Vegetal localization of maternal mRNAs is disrupted by VegT depletion., Dev Biol 2001      
Most recent: Ascl1 represses the mesendoderm induction in Xenopus., Acta Biochim Biophys Sin (Shanghai) 2016  
View All Papers