Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250590

Morpholino Name: vegt MO6
Synonyms: VegTMO
mRNA Target: vegt

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCCCGACAGCAGTTTCTCATTCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' TGCAATGAGAAACTGCTGTCAGGAA 3' || ||||||||||||||||| |||| 3' ACCTTACTCTTTGACGACAGCCCTT 5' 5' TGGAATGAGAAACTGCTGTCGGGAA 3' ||||||||||||||||||||||||| 3' ACCTTACTCTTTGACGACAGCCCTT 5' 5' TGGAATGAGAAACTGCTGTCGGGAA 3' ||||||||||||||||||||||||| 3' ACCTTACTCTTTGACGACAGCCCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold162663:567777..567801 25/25 Antisense target vegt.L
Scaffold97703:133803..133827 25/25 Antisense target vegt.S
Scaffold12020:8344080..8344104 22/25 unknown
Scaffold111824:2831291..2831315 21/25 unknown
Scaffold179377:368758..368782 21/25 unknown
Scaffold58517:5362032..5362056 21/25 unknown
Scaffold81941:1519576..1519600 21/25 Sense off-target cox10.L
tropicalis 7.1 scaffold_1:55047285..55047309 23/25 Antisense target vegt
scaffold_5:96040212..96040236 22/25 unknown
scaffold_10:37297206..37297230 21/25 Antisense off-target taf4
Publications
First: Reversal of Xenopus Oct25 function by disruption of the POU domain structure., J Biol Chem 2010  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556