Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250591

Morpholino Name: vegt MO7
Synonyms: vegt MO
mRNA Target: vegt

Morpholino Type: uncategorized morpholino
Sequence:
5' CCCGACAGCAGTTTCTCATTCCACG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 23/25 23/25
genomic

MO
5' GCTGCAATGAGAAACTGCTGTCAGG 3' || ||||||||||||||||| || 3' GCACCTTACTCTTTGACGACAGCCC 5' 5' GCTGGAATGAGAAACTGCTGTCGGG 3' ||||||||||||||||||||||| 3' GCACCTTACTCTTTGACGACAGCCC 5' 5' GCTGGAATGAGAAACTGCTGTCGGG 3' ||||||||||||||||||||||| 3' GCACCTTACTCTTTGACGACAGCCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:152598799..152598823 23/25 Antisense target vegt.L
chr1S:126245226..126245250 23/25 Antisense target vegt.S
chr7L:4032252..4032276 21/25 Antisense off-target eno4.L
tropicalis 10.0 Chr1:152863076..152863100 21/25 Antisense target vegt
Publications
First: Long- and short-range signals control the dynamic expression of an animal hemisphere-specific gene in Xenopus., Dev Biol 2008              
Most recent:
View All Papers