Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250592

Morpholino Name: vegt MO8
Synonyms: apod MO
mRNA Target: vegt

Morpholino Type: uncategorized morpholino
Sequence:
5' CCTTGTACGTAAGAGACGGCCTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: The RNA-binding protein XSeb4R: a positive regulator of VegT mRNA stability and translation that is required for germ layer formation in Xenopus., Genes Dev 2008            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556