Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250593

Morpholino Name: ventx2.1 MO1
Synonyms: Xvent2
mRNA Target: ventx2.1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTGTCTGTATTAGTCCTTGTGTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25 25/25
genomic

MO
5' GAACACAAGGACTACTACAGGAAAG 3' |||||||||||||| ||||| ||| 3' CTTGTGTTCCTGATTATGTCTGTTC 5' 5' GAACACAAGGACTAATACAGACAAG 3' ||||||||||||||||||||||||| 3' CTTGTGTTCCTGATTATGTCTGTTC 5' 5' GAACACAAGGACTAATACAGACAAG 3' ||||||||||||||||||||||||| 3' CTTGTGTTCCTGATTATGTCTGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16863:2485287..2485311 25/25 Antisense target ventx2.1.S
Scaffold295070:2..26 25/25 unknown
Scaffold7555:1662289..1662313 25/25 Antisense target ventx2.1.L
Scaffold227593:1584995..1585019 22/25 unknown
Scaffold3586:1434311..1434335 22/25 Antisense off-target rabepk.L
Scaffold200825:425640..425664 21/25 unknown
tropicalis 7.1 scaffold_7:21483243..21483267 22/25 Antisense off-target ventx2.2
scaffold_7:21510951..21510975 22/25 Antisense target ventx2.1
scaffold_4:20631699..20631723 21/25 unknown
scaffold_8:15458486..15458510 21/25 Antisense off-target rabepk
Publications
First: Patterning the forebrain: FoxA4a/Pintallavis and Xvent2 determine the posterior limit of Xanf1 expression in the neural plate., Development 2004    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556