Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250594

Morpholino Name: vps35 MO1
Synonyms: Vps35
mRNA Target: vps35

Morpholino Type: uncategorized morpholino
Sequence:
5' GGACTGCTGGGTCGTGGGCATCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' GTTATAGCCCACGACCCAGCAGTCC 3' | | ||||||||||||||||||| 3' CTACTACGGGTGCTGGGTCGTCAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:61239876..61239900 21/25 Antisense target vps35.L
Publications
First: Xenopus Wntless and the retromer complex cooperate to regulate XWnt4 secretion., Mol Cell Biol 2009    
Most recent: The Sorting Nexin 3 Retromer Pathway Regulates the Cell Surface Localization and Activity of a Wnt-Activated Polycystin Channel Complex., J Am Soc Nephrol 2017  
View All Papers