Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250596

Morpholino Name: was MO1
Synonyms: Wasp MO
mRNA Target: was

Morpholino Type:
Sequence:
5' CCATTTTAGGCCCCCCTCGGCTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' ATGAGTCGAGGGGGGCCTAAAACTG 3' ||||| |||||||||||||||| | 3' TACTCGGCTCCCCCCGGATTTTACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold50079:4865762-4865786 25/25 unknown
Scaffold356308:116426-116450 22/25 Antisense target was.L
Scaffold36364:6223332-6223356 22/25 unknown
Publications
First: Abelson interactor 1 (ABI1) and its interaction with Wiskott-Aldrich syndrome protein (wasp) are critical for proper eye formation in Xenopus embryos. [J Biol Chem 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556