Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250596

Morpholino Name: was MO1
Synonyms: Wasp MO
Target mRNA: was

Morpholino Type: uncategorized morpholino
Sequence: 5' CCATTTTAGGCCCCCCTCGGCTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' ATGAGTCGAGGGGGGCCTAAAACTG 3' ||||| |||||||||||||||| | 3' TACTCGGCTCCCCCCGGATTTTACC 5' 5' ATGAGCCGAGGGGGGCCTAAAATGG 3' ||||||||||||||||||||||||| 3' TACTCGGCTCCCCCCGGATTTTACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:85018731..85018755 25/25 Antisense target was.S
chr8L:604714..604738 22/25 Antisense target was.L
chr2S:1828970..1828994 22/25 unknown
Publications
First: Abelson interactor 1 (ABI1) and its interaction with Wiskott-Aldrich syndrome protein (wasp) are critical for proper eye formation in Xenopus embryos., J Biol Chem 2013  
Most recent:
View All Papers