Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250597

Morpholino Name: wdr5 MO1
Synonyms: wdr5
mRNA Target: wdr5

Morpholino Type:
Sequence:
5' CATGGTGTCAGCACTAGAATGGTCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 22/25
genomic

MO
5' GCACCATTCTAGTGCTGACACCATG 3' ||||||||||||||||||||||| 3' GCTGGTAAGATCACGACTGTGGTAC 5' 5' GCACCATTCTAGTGCTTACACCATG 3' |||||||||||||| |||||||| 3' GCTGGTAAGATCACGACTGTGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold255149:311408-311432 23/25 Antisense target wdr5.L
Scaffold251007:201082-201106 22/25 Antisense target wdr5.S
tropicalis 7.1 scaffold_5:22775037-22775061 21/25 Antisense off-target tsc22d2
Publications
First: WD repeat-containing protein 5, a ubiquitously expressed histone methyltransferase adaptor protein, regulates smooth muscle cell-selective gene activation through interaction with pituitary homeobox 2. [J Biol Chem 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556