Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250597

Morpholino Name: wdr5 MO1
Synonyms: wdr5
Target mRNA: wdr5

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CATGGTGTCAGCACTAGAATGGTCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 22/25
genomic

MO
5' GCACCATTCTAGTGCTGACACCATG 3' ||||||||||||||||||||||| 3' GCTGGTAAGATCACGACTGTGGTAC 5' 5' GCACCATTCTAGTGCTTACACCATG 3' |||||||||||||| |||||||| 3' GCTGGTAAGATCACGACTGTGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:5469117..5469141 23/25 Antisense target wdr5.L
chr8S:30232128..30232152 22/25 Antisense target wdr5.S
tropicalis 10.0 Chr5:118448538..118448562 21/25 Antisense off-target tsc22d2
Publications
First: WD repeat-containing protein 5, a ubiquitously expressed histone methyltransferase adaptor protein, regulates smooth muscle cell-selective gene activation through interaction with pituitary homeobox 2., J Biol Chem 2011    
Most recent:
View All Papers